Implicating SCF complexes in organogenesis in C. elegans

Development of the Caenorhabditis elegans foregut (pharynx) is regulated by a network of proteins that includes the Retinoblastoma protein (pRb) ortholog LIN-35, the ubiquitin pathway components UBC-18 and ARI-1, and by PHA-1, a cytoplasmic protein. Loss of pha-1 activity impairs pharyngeal development and body morphogenesis, leading to embryonic arrest. We have used a genetic suppressor approach to dissect this complex pathway. The lethality of pha-1 mutants is suppressed by loss-of-function mutations in sup-35/ztf-21 and sup-37/ztf-12, which encode Zn-finger proteins, and by mutations in sup-36. Here we show that sup-36 encodes a divergent Skp1 family member that binds to several F-box proteins and the microtubule-associated protein PTL-1/tau. Like SUP35, SUP-36 levels were negatively regulated by UBC-18–ARI-1. We also found that SUP-35 and SUP-37 physically associated and that SUP-35 could bind microtubules. Thus, SUP-35, SUP-36, and SUP-37 may function within a pathway or complex that includes cytoskeletal components. Additionally, SUP-36 may regulate the subcellular localization of SUP-35 during embryogenesis. We carried out a genome-wide RNAi screen to identify additional regulators of this network and identified 39 genes, most of which are associated with transcriptional regulation. Twenty-three of these genes acted via the LIN-35 pathway. In addition, several Skp1–Cullin–F-Box (SCF) components were identified, further implicating SCF complexes as part of the greater network controlling pharyngeal development. INTRODUCTION The analysis of suppressor and enhancer mutations is an invaluable tool for elucidating the molecular pathways and networks that control animal development. Using this approach, we have identified a multi-gene module that controls organogenesis of the C. elegans pharynx (foregut). This network includes the C. elegans Retinoblastoma-family ortholog, LIN-35/pRb, and a conserved E2-E3 ubiquitin-modification complex, UBC18/UBCH7–ARI-1/AR1H1 (FAY et al. 2003; QIU and FAY 2006). LIN-35 and UBC-18– ARI-1 negatively regulate a Zn-finger protein, SUP-35/ZTF-21, at the level of transcription and protein stability, respectively (MANI and FAY 2009). Furthermore, SUP35, along with a second Zn-finger protein, SUP-37/ZTF-12, functionally opposes PHA-1, a novel cytoplasmic protein that is required for C. elegans embryonic development (FAY et al. 2012; FAY et al. 2004; GRANATO et al. 1994; SCHNABEL and SCHNABEL 1990). Our working model is that in the absence of both lin-35 and ubc-18 activities, SUP-35 levels are abnormally elevated, which in turn interferes with the ability of PHA-1 to carry out essential functions during embryogenesis. Loss-of-function (LOF) mutations in pha-1 lead to gross defects in pharyngeal development and body morphology (FAY et al. 2012; FAY et al. 2004; SCHNABEL and SCHNABEL 1990). Specifically, PHA-1 plays a role in both establishing and maintaining a stable attachment between the anterior epithelial cells of the developing pharynx and the arcade cells that comprise the future buccal cavity (mouth) (FAY et al. 2004). This is in part due to the failure of anterior pharyngeal epithelial cells to undergo stereotypical changes in shape and apical-basal polarity, a step that has been termed reorientation (FAY et al. 2004; PORTEREIKO and MANGO 2001). When reorientation fails, a connection between the pharynx and arcade cells does not form, which precludes the generation of an intact intestinal tract (PORTEREIKO et al. 2004). The result is a highly penetrant pharynx unattached (Pun) phenotype, whereby animals are unable to feed and therefore arrest as L1 larvae. In addition, strong LOF mutations in pha-1 lead to gross defects in body morphogenesis, which prevent animals from completing embryogenesis and hatching. Similar phenotypes are also observed in lin-35; ubc-18 mutants, as well as in other related compound mutants, and in strains that overexpress SUP-35 (FAY et al. 2003; MANI and FAY 2009). Notably, LOF mutations in sup-35 and sup-37 completely suppress the lethality of pha-1 LOF mutants, including several molecular nulls (FAY et al. 2012; MANI and FAY 2009; SCHNABEL et al. 1991). This observation, together with other data, has led to the hypothesis that SUP-35 and SUP-37 act in a pathway or complex that is in opposition to PHA-1, possibly through the regulation of a mutual downstream target or biological processes. In addition, LOF mutations in sup-35 and sup-37 suppress the synthetic lethality of lin-35; ubc-18, lin-35; pha-1, and ari-1; pha-1 double mutants (FAY et al. 2012; FAY et al. 2004; MANI and FAY 2009; QIU and FAY 2006). Here we describe the molecular characterization of sup-36, a gene in which mutations are capable of suppressing the lethality of pha-1 and lin-35; ubc-18 mutants. sup-36 encodes a Skp1related protein that binds to several F-box proteins and to the microtubule-associated protein PTL-1/tau. In addition, by carrying out a genome-wide RNAi screen for suppressors of lin-35; ubc-18 larval lethality, we have identified 37 additional genes whose functions intersect with this regulatory network. Materials and Methods Strains and maintenance C. elegans strains were maintained according to standard methods (STIERNAGLE 2005). Strains used in this study include GE24 [pha-1(e2123) III], WY83 [lin-35(n745) I; ubc18(ku254) III; kuEx119 (lin-35+; sur-5::GFP)], WY119 [lin-35(n745) I; pha-1(fd1) III; kuEx119], WY163 [pha-1(e2123) III; sup-36(e2217) IV], GE341 [pha-1(e2123) dpy18(e499) III; sup-36(e2217) IV], GE342 [pha-1(e2123) dpy-18(e499) III; sup-36(e2218) IV], GE391 [pha-1(e2123) dpy-18(e499) III; sup-37(t1012) IV], GE397 [pha-1(e2123) dpy-18(e499) III; sup-36(t1956) IV], GE398 [pha-1(e2123ts) dpy-18(e499) III; sup36(t1957) IV], WY160 [pha-1(e2123) backcrossed five times to CB4856], WY158 [pha1(e2123) III; dpy-13(e184) unc-24(e138) IV]. WY805 [pha-1(e2123) III; sup-36(e2217) IV; fdEx201], WT512 [; sup-36(t1956) IV; fdEx57(rol-6(gf) + SUP-35::GFP)]; WY865 [ari1(tm2549) I; pha-1(e2123) III; fdEx201(pha-1+; sur-5::RFP)]; WY729 [pha-1(e2123) III; fdEx121(wild-type sup-36 + surp-5::GFP)]; WY730 [pha-1(e2123) dyp-18(e499); fdEx121(sup-36 genomic locus + sur-5::GFP)], WY862 [sup-35(tm1810) III; sup36(e2217) IV; sup-37(e2215) V; Ex(Ppha-1::GFP)], WY925 [fdEx115(rol-6(gf); SUP36::GFP)], WY999 [fdEx57]; WY1000 [sup-35(tm1810) III; sup-36(e2217) IV; sup37(e2215) V; fdEx238(rol-6(gf); SUP-36::GFP)]. Deletion alleles for sup-36 (tm3912), pha-1 (tm3569 and tm3671), and ari-1 (tm2549) were obtained from the National BioResource Project (NBRP) Japan. Genetic mapping and molecular identification of sup-36 Preliminary mapping placed sup-36 on LGIV (data not shown; (SCHNABEL et al. 1991). To narrow the sup-36 genomic region, three-point mapping was performed using the balanced strain pha-1(e2123) III; dpy-13(e184) unc-24(e138)/sup-36(e2217) IV. Of the progeny, 6/53 Dpy non-Unc and 82/87 Unc non-Dpy animals acquired the sup-36 mutation. For single-nucleotide polymorphism (SNP) mapping, pha-1(e2123) hermaphrodites were backcrossed five times to CB4856 Hawaiian males, and the resulting pha-1(e2123); CG4856–5 males (WY160) were crossed to pha-1(e2123); dpy-13 sup-36(e2217) unc-24 hermaphrodites, followed by standard SNP mapping procedures (FAY 2006). After an analysis of ~500 Dpy non-Unc and Unc non-Dpy recombinants, the sup-36 mutation was isolated to an ~80-kb region containing 38 genes between SNPs located on cosmids C01G5 and C01B10. Rescue experiments were performed by amplifying a 1,984-bp PCR fragment (chromosome IV 6,600,477– 6,602,461) encompassing the sup-36 genomic region from wild-type animals using primers 5'-GAAGAGTCTAATTAAGAGTACTGCCGA-3' and 5'AGATTTGTGAGCACATTTCGAGA-3'. Sequence alignments Alignments were carried out using MAFFT (http://www.ebi.ac.uk/Tools/msa/mafft/) and MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/). After the alignments were reformatted in Phylip4 (http://www.ebi.ac.uk/cgi-bin/readseq.cgi), model testing was carried out (http://darwin.uvigo.es/software/prottest2_server.html), and optimal models were used to generate trees (http://www.atgc-montpellier.fr/phyml/). Both MAFFT and MUSCLE alignment programs produced nearly identical dendrograms (data not shown). Microscopy Quantitative fluorescence microscopy was performed using a Nikon Eclipse microscope. Quantification of GFP fluorescence in embryos was carried out using Open Lab Software Version 5.0.2. All images were captured using identical exposure times, and all embryos used in our analysis were of similar developmental stages (~200–300 cells). Averages of the mean fluorescence were calculated to compare expression levels. p-values were determined using a two-tailed Student’s t-test. Confocal images were acquired using a 100 (1.4 NA) or 60 (1.49 NA) objective on an Olympus IX-71 inverted microscope. The microscope was equipped with a CSU-X1 spinning disc head (Yokogawa) and cooled EMCCD camera (ImagEM, Hamamatsu). Image acquisition and microscope automation were controlled using Metamorph software (Molecular Devices). Yeast two-hybrid (Y2H) analysis Physical interactions between SUP-36 and FBXC-53, FBXC-32, FBXC-20, and PTL-1 were tested by Y2H analysis using the ProQuest Two-Hybrid System (Invitrogen). Bait and prey plasmids were generated using the Gateway cloning system. Gateway entry clones for fbxc-53, fbxc-32, and fbxc-20 were a generous gift from Michael Calderwood and Mark Vidal (LI et al. 2004; SIMONIS et al. 2009). To generate a Gateway entry clone for ptl-1, a ptl-1a cDNA was PCR amplified using the following primers: 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGTCAACCCCTCAATCAG-3’ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTTCATAACGAGCTGATGTC-3’. The resulting amplicon was cloned into the donor vector pDONR221. Genes in the entry clones were transferred to the yeast expression vectors in a Gateway LR recombination reaction with the bait destination vector pDEST32 (sup-36) or the prey destination vector pDEST22 (fbxc-53, fbxc-32, fbxc-20, and ptl-1a). All plasmids were sequenced and tested for self-activation of the reporter HIS3 by growth on histidine-minus medium in the presence of varying levels of 3-amino-1,2,4-triazole (3-AT). Yeast strain MaV203 was co-transformed with the sup-36 bait vector (or the control empty bait vector) and each of the prey vectors (or the control empty prey vector). Transformants were patched onto a SC-Leu-Trp master plate along with the negative activation controls (bait with empty prey vector and preys with empty bait vector) and positive and negative interaction controls supplied by Invitrogen. After 18 hr of incubation at 30C, patches were replica plated to SC-Leu-Trp-Ura and SC-Leu-Trp-His + 25 mM 3-AT plates, and the latter were immediately replica cleaned. Plates were then incubated at 30C for 24 hr, replica cleaned, and incubated for 48 hr at 30C. To test for inhibition of growth on 5fluoroorotic acid (5-FOA) plates, candidate yeast colonies were streaked onto 0.2% 5FOA selection plates and the extent of colony growth was determined after 72 hr. The quantitative assay for -galactosidase (-gal) activity was performed following the manufacturer’s instructions in liquid cultures using chlorophenol red--Dgalactopyranoside (CPRG) as a substrate. β-gal levels were calculated using the following equation: β-gal = (1,000  absorbance at 574 nm)/[(duration of reaction)  (sample volume)  (absorbance at 600 nm)]. Controls supplied by Invitrogen were as follows: strong positive interaction, Krev1/RalGDS-wt; weak positive interaction, Krev1/RalGDS-m1; and negative interaction control, Krev1/RalGDS-m2. SUP-36 reporter plasmid construction A SUP-36::GFP translation fusion reporter was generated by amplifying coding sequences along with the 5’-regulatory region of sup-36 from N2 genomic DNA using primers 5'-CTGCCGAGTTTGAATAAAGAT-3' and 5'CATGAGTCTAGATAGTGCAAGTTCTGAAATGAT-3'. The DNA fragment was digested with HindIII and XbaI and was then cloned into corresponding sites in pPD95.75 (Addgene). Sequence analysis was used to confirm the absence of mutations. A Psup36::GFP transcriptional fusion reporter was generated by amplifying with primers 5'CTGCCGAGTTTGAATAAAGAT-3' and 5'CATGAGTCTAGATAGTGCAAGTTCTGAAATGAT-3', digesting with HindIII and XbaI, and cloning into the corresponding sites in pPD95.75.